![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
- Task Title: Completing genotyping of composite germplasm set of barley:
- Involved institutions:The International Centre for Agricultural research in the Dry Areas (ICARDA), P.O. Box 5466, Aleppo, Syria Drs. J. Valkoun, S. Grando and M. Baum (J.Valkoun@cgiar.org, S.Grando@cgiar.org, M.Baum@cgiar.org).
Chinese Acadamy of Agricultural Science (CAAS) Dr. Zhang Jing,
Expert advice available from: Scottish Crop Research Institute (SCRI) Invergowrie, Dundee DD2 5DA (UK) Tel.: 44 1382 562731 - Fax: 44 1382 562426 Dr. Joanne Russell E-mail: russell@scri.sari.ac.uk
- Proposed Task Leader: Michael Baum, ICARDA
- Rationale and Objective:The application of association genetics through linkage disequilibrium studies of germplasm adapted to key regions represents an innovative solution to the problem of identifying markers for genomic regions key to specific characteristics (Risch and Merikangas, 1996; Nordborg and Tavaré, 2002). Linkage Disequilibrium (LD) mapping is a relatively new concept in plant breeding, developed in human genetics, to facilitate trait-marker allele association (Risch and Merikangas, 1996; Cardon and Bell, 2001; Boehnke, 2000; Clayton 2000; Nordborg and Tavaré, 2002). By using LD, association between marker alleles and a trait can be identified particularly when the trait has a binary nature, such as occurrence or not. The application of LD outside the single gene context meets with scepticism. However, such scepticism has mainly an empirical basis, as it is based on little data and is probably due to the use of non-optimal statistical methods. The efficient implementation of MAS requires association and QTL detection methods that can be applied in multiple related crosses using populations that are directed more toward the situation in a practical breeding program.
The application of a low-resolution screen to a range of genotypes, followed by more detailed study of candidate genes in the region, will enable a selective filtration of the vast accumulation of genomic information to target factors that will be key to adaptation to the specific environments chosen for this project. This change to functional markers more relevant to target traits is expected to result in information that can then be utilised in a robust MAS scheme for barley improvement in such areas, as well as serving as a demonstration project for the selective improvement of other crops. Certainly, deployment of a strategy implementing MAS to form a pool of elite germplasm fixed for key target QTLs, followed by phenotypic selection to identify the best of these, would improve the efficiency of barley breeding. This would be because expensive yield trialling can be concentrated upon lines that are most likely to meet desired standards and the overall numbers of lines in advanced trials would consequently be reduced without reduction in genetic gain.
- Activity 1: Assembling datasets: The FAO estimates that more than 350,000 accessions of barley genetic resources are conserved in numerous ex situ collections. Significant overlap exist between collections. Genetic Resources Unit (GRU) of ICARDA in collaboration with European Barley Database (EBDB) and major barley collections has compiled a Global Inventory of Barley Genetic Resources. The project was supported by the System-wide Information Network for Genetic Resources (SINGER). The Inventory lists more than 165,000 accessions from 40 institutes/genebanks. Approximately 40% of a global collection refers to landraces, collected in the field, or selections from landraces. The inventory identified over 280 collection missions to 57 countries during the period 1921-2001. Whenever the collection site data were sufficiently detailed, the collection sites were geo-referenced to facilitate production of distribution maps and links with GIS. As expected, majority of conserved material is the result of breeding efforts and we attempted to cross-reference accessions using standardized names. For large part of breeding material the system also records pedigree, developer and date of release. Approximately 60% of ICARDA’s cereal collections are geo-referenced. Using GIS to establish the climate at collection sites, germplasm accessions from markedly hot and dry locations are being preferentially screened for drought tolerance and heat tolerance to combat climate change in order to optimize the exploitation of the extensive collections of wild and cultivated genetic resources.
ICARDA holds 22,589 FAO-designated accessions of barley from 91 countries, however the main focus is of course the West Asia and North Africa region. For the collection of 3000 accessions both wild and cultivated were selected using climatic variables (65) and soil and salinity information. The cultivated barley in the collection consists of a total of 2074 landrace accessions: 1616 accessions with ecological information available, 85 countries, 1371 collection sites (1312 dryland), 256 ecological clusters, a total of 626 accessions of improved germplasm (cultivars, unreleased breeder's material, research material, genetic stocks), 614 pedigrees available, 73 countries. Additionally, 300 accessions of H. spontaneum were incuded, 15 countries, 288 collection sites (250 dryland, AI <0.5), 51 ecological clusters.
Activity 2: Identifying statistical methodologies and selection criteria Statisticians and genetic resources experts from ICARDA and CAAS will identify the most appropriate selection criteria and statistical methodologies to identify a core and a mini-core collection. A range of methodologies is already well established for selecting subsets of collections optimized for particular purposes. ICARDA will take responsibility for ensuring that these methodologies are appropriately exploited, and where appropriate will seek external opinion (e.g. SCRI).
- Activity 3: Analysing data: Genetic similarity matrices will be obtained by SIMQUAL sub-routine of the NTSYS-pc software statistical package (Rolf 1990) based on the Jaccard’s algorithms. The similarity coefficients will be used to construct genetic distance phenograms using the SAHN method based on UPGMA.
- Activity 4: Selecting accessions: Based on the results of activity 3, ICARDA and CAAS will tentatively identify accessions to include in the primary composite collections and in the mini-composite collections. The proposal will be refined by partners for the crops, and then by discussion with the clusters and sub-programmes that will use the germplasm.
- Activity 5: Selecting SSRs and EST-derived SSRs: SSR and ESR-SSRs have been identified form region that are known to carry important quantitative trait loci (QTL). For an extensive review of QTL in this species see: Thomas (2002) and the web page of the North American Barley Genome Mapping Project: http://www.css.orst.edu/barley/nabgmp/QTL71400.htm.
- Activity 6: Integrating passport data, molecular and phenotypic information under ICIS: We are establishing the ICIS GMS and DMS and the lines we are genotyping should all be already included the ICIS GMS. We will then use the unique ID's in the Germplasm Management System to reference the molecular information generated and organised into the Gene Management System. This information will be stored in split MS ACCESS databases depending on the size of the information generated for speed and storage convinience.
Table 1. Barley Database structure in ICIS Data in DMS
Data in GEMS
Figure 1: Linking of Phenotypic Data in DMS to GEMS by cultivar name or GID from DMS Reference links to addresses in split Ms Access image databases
- Expertise:
International Center for Agricultural Research in the Dry Areas - Germplasm Program, Aleppo, Syria P.O.Box : 5466 Tel.: 00963-21-2213430 – Fax: 00963-21-2213490 E-mail: M.Baum@cgiar.org
The Center: The International Center for Agricultural Research in the Dry Areas (ICARDA), based at Aleppo, Syria is one of the 16 Centers supported by the Consultattive Group on International Agricultural Research (CGIAR). ICARDA’s research provides global benefits of poverty alleviation through production improvement integrated with sustainable natural resource management practices. ICARDA serves the entire developing world for the improvement of barley.
Expertise and experience in barley breeding: ICARDA has a long history of planning and implementing research in cooperation with its NARS partners throughout West Asia and North Africa (WANA). The barley improvement project at ICARDA aims at a sustainable increase in barley productivity by adapting the crop to the different farming systems and uses in developing countries with special emphasis in those areas where the crop is grown by resource-poor farmers, thus contributing to alleviation of poverty.
Expertise and experience in Biotech: ICARDA has a fully established molecular marker laboratory. Multifluorophore fragment analysis can be carried out on an ABI prism TM 377 DNA Sequencer and analyzed with GeneScanTM analysis software version 2.0.2 and Genotyper TM analysis software version 2.0 (PE Applied Biosystems) and ABI3100 capillary sequencer withGenMapper software, a Genescan 5000 microarray reader, ABI7500 real time.
Recent Selected Research Grants: · “Exploration of Genetic Resources Collections at ICARDA for Adaptation to climate Change: Identification and Utilization of Sources of Stress Tolerance”, 2003-2005, in collaboration with A. Graner, IPK-Gatersleben, Germany. · “Functional Genomics of Drought and Cold Tolerance in ICARDA-mandated Legumes: Chickpea and Lentil”. 2002-2004 in collaboration with the University of Frankfurt, G. Kahl.
Recent refereed journal articles: Sayed H., G. Backes, H. Kayyal, A. Yahyaoui, S. Ceccarelli, S. Grando, A. Jahoor, M. Baum (2004). New molecular markers linked to qualitative and quantitative powdery mildew and scald resistance genes in barley for dry areas. Euphytica 135: 225–228, 2004.
Baum M, Grando S, Backes G, Jahoor A, Sabbagh A, Ceccarelli S (2003) QTLs for agronomic traits in the Mediterranean environment identified in recombinant inbred lines of the cross ‘Arta’ x H. spontaneum 41-1. (Theor Appl Genet (2003) 107:1215–1225
Russell JR, Booth A, Fuller JD, Baum M, Ceccarelli S, Grando S, Powell W (2003) Patterns of polymorphism detected in the chloroplast and nuclear genomes of barley landraces sampled from Syria and Jordan. Theor Appl Genet : 107: 413 - 421 Eujayl I, Sorrells M, Baum M, Wolters P, Powel l (2002). Isolation of EST-derived microsatellite markers for genotyping the A and B genomes of wheat. Theor Appl Genet (2002) 104:399–407
- Foreseen activities:The selected barley germpalsm will be grown at ICARDA and DNA extracted. Quantified DNA will be sent to CAAS for genotyping. 1500 accessions will be genotyped at CAAS, 1000 accessions at ICARDA. The following 50 loci that have already been used for genotyping the 500 accessions (250 Syrian Jordanian landraces, 250 Chinese landraces) will be used to genotype the remaining 2500 accessions. |
|
Item |
|
Subtotal |
|
CAAS |
|
|
|
Genotyping with 30 SSRs at CAAS (labelled markers are available, M13 labelled SSRs) |
|
60.000 |
|
1 CAAS scientists to ICARDA (1 month) |
|
5.000 |
|
|
Subtotal CAAS |
65.000 |
|
ICARDA |
|
|
|
DNA extraction |
|
10.000 |
|
Genotyping with 20 SSRs at ICARDA (labelled markers are available, direct labelled SSRs ) |
|
35.000 |
|
Data analysis Consultant (1 months at ICARDA) |
|
7.000 |
|
ICARDA scientist to CAAS 1 week |
|
3.000 |
|
|
Subtotal ICARDA |
55.000 |
|
Overhead 18% |
|
9.900 |
|
|
|
129.900 |
Table 1. SSR (genomic and EST-SSR markers) available for genotyping. Sequnces of EST-SSRs are underpublication and will bemade available once published.
|
Locus |
|
Forward Primer |
Reverse Primer |
Size and type |
|
Bmac0399 |
1H |
CGATGCTTTACTATGAGAGGT |
GGGTCTGAAGCCTGAAC |
145 |
|
Bmag0211 |
1H |
ATTCATCGATCTTGTATTAGTCC |
ACATCATGTCGATCAAAGC |
174 |
|
Bmag0382 |
1H |
TGAAACCCATAGAGAGTGAGA |
TCAAAAGTTTCGTTCCAAATA |
109 |
|
scssr10477 |
1H |
|
|
|
|
HvHVA1 |
1H |
CATGGGAGGGGACAACAC |
CGACCAAACACGACTAAAGGA |
136 |
|
scssr02748 |
1H |
|
|
Contig Indel |
|
Bmac0134 |
2H |
CCAACTGAGTCGATCTCG |
CTTCGTTGCTTCTCTACCTT |
148 |
|
HVM36 |
2H |
TCCAGCCGACAATTTCTTG |
AGTACTCCGACACCACGTCC |
114 |
|
scssr07759 |
2H |
|
|
Contig Indel |
|
scssr00334 |
2H |
|
|
Contig Indel |
|
Bmag0125 |
2H |
AATTAGCGAGAACAAAATCAC |
AGATAACGATGCACCACC |
134 |
|
EBmac0415 |
2H |
GAAACCCATCATAGCAGC |
AAACAGCAGCAAGAGGAG |
247 |
|
scssr08447 |
2H |
|
|
Contig Indel |
|
HvLTPPB |
3H |
AGACGCTGAGTACGTTGAG |
CAAAGTACAACAAACTCACGA |
221 |
|
scssr10559 |
3H |
|
|
Contig Indel |
|
Bmac0067 |
3H |
AACGTACGAGCTCTTTTTCTA |
ATGCCAACTGCTTGTTTAG |
171 |
|
scssr25691 |
3H |
|
|
Contig Indel |
|
scind05281 |
3H |
|
|
EST Indel |
|
HVM62 |
3H |
TCGCGACCAGACGAGAAG |
AGCTAGCCGACGACGCAC |
251 |
|
scssr25538 |
3H |
|
|
Contig Indel |
|
HVM40 |
4H |
CGATTCCCCTTTTCCCAC |
ATTCTCCGCCGTCCACTC |
160 |
|
scssr20569 |
4H |
|
|
Contig Indel |
|
scssr18005 |
4H |
|
|
Contig Indel |
|
Bmag0353 |
4H |
ACTAGTACCCACTATGCACGA |
ACGTTCATTAAAATCACAACTG |
119 |
|
scssr14079 |
4H |
|
|
Contig Indel |
|
EBmac0701 |
4H |
ATGATGAGAACTCTTCACCC |
TGGCACTAAAGCAAAAGAC |
149 |
|
Bmag0419 |
4H |
AATTAGTACCTAGATGGCAAT |
GAATTACATTGGATGGATG |
116 |
|
scssr02306 |
5H |
|
|
Contig Indel |
|
scssr07106 |
5H |
|
|
Contig Indel |
|
scind02587 |
5H |
|
|
EST Indel |
|
scind16991 |
5H |
|
|
EST Indel |
|
scssr05939 |
5H |
|
|
Contig Indel |
|
scssr10148 |
5H |
|
|
Contig Indel |
|
scssr03907 |
5H |
|
|
Contig Indel |
|
scssr09398 |
6H |
|
|
Contig Indel |
|
scind60002 |
6H |
|
|
EST Indel |
|
Bmac0018 |
6H |
GTCCTTTACGCATGAACCGT |
ACATACGCCAGACTCGTGTG |
138 |
|
Bmag0009 |
6H |
AAGTGAAGCAAGCAAACAAACA |
ATCCTTCCATATTTTGATTAGGCA |
172 |
|
scssr05599 |
6H |
|
|
Contig Indel |
|
scssr00103 |
6H |
|
|
Contig Indel |
|
scind60001 |
6H |
|
|
EST Indel |
|
HVM4 |
7H |
CCAGTCCAATGGCATCTACA |
GCAAAGTCGTCGAAGGAGAA |
|
|
scssr07970 |
7H |
|
|
Contig Indel |
|
scssr15864 |
7H |
|
|
Contig Indel |
|
HvCMA |
7H |
GCCTCGGTTTGGACATATAAAG |
GTAAAGCAAATGTTGAGCAACG |
141 |
|
scind00149 |
7H |
|
|
EST Indel |
|
Bmac0581 |
7H |
ACATCCCGACCCCAAAGT |
CGATCTTGGTGTGTGTGCAT |
149 |
|
scssr04056 |
7H |
|
|
Contig Indel |