![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1. Task Title : Genotyping a composite germplasm set of lentil:
2. Involved institutions:
3. Proposed Task Leaders: Bonnie J. Furman and Michael Baum, ICARDA
4. Proposed Collaborators: Christian Jung, Universität Kiel
5. Background information and rational: Lentil (Lens culinaris Medik.) is an important cool-season crop in North Africa, West Asia, the Middle East, the Indian Subcontinent and North America (Erskine 1996). It is an important source of dietary protein (25 percent) in both human and animal diets, second only to soybeans as a source of usable protein (CGIAR). Lentil ranks seventh among grain legumes and is grown on over 3.5 million hectares in over 48 countries with a total production of over 3 million metric tons. The major lentil producing regions are Asia (58 percent of the area) and the West Asia-North Africa region (37 percent of the acreage of developing countries).
The genus Lens comprises seven taxa within four species including the cultivated type, Lens culinaris spp. culinaris (Ferguson and Erskine 2001). Cultivated lentil includes two varietal types: small-seeded microsperma and large-seeded macrosperma. Wild Lens species are represented by L. culinaris spp. orientalis, L. odemensis, L. nigrican and L. ervoides. All members of Lens are self-pollinating diploids (2n = 2x = 14; Sharma et al. 1995). The haploid genome size of the cultivated genome is 4063 Mbp (Arumuganathan and Earle 1991). The Generation Challenge Program Subprogramme 1 has the main goal of exploring genetic diversity of global germplasm collections of the Consultative Group of International Agricultural Research (CGIAR). For each crop, a "composite sets" of germplasm, representing the range of diversity of each crop species and its wild relatives, will be identified and characterized with anonymous molecular markers. This molecular characterization will allow for a study of the diversity across a given genus as well as potentially identify candidate genes involved in resistance to biotic and abiotic stresses, thus providing the base for the research activities of the other 4 subprogrammes. The International Centre for Agriculture in Dry Areas (ICARDA) has a global mandate for research on lentil improvement. As such, ICARDA houses the world collection of Lens, totaling 10,509 accessions. The ICARDA collection includes 8789 accessions of cultivated lentil from 70 different countries, 1146 ICARDA breeding lines, and 574 accessions of 6 wild Lens taxa representing 23 countries. From this collection, a composite germplasm set of approximately 1000 accessions will be identified and characterized utilizing molecular microsatellite markers.
Analysis of microsatellite DNA loci is the current method of choice for population analyses (e.g., Morgante and Olivieri. 1993, Vendramin et al. 1998). Microsatellite loci consist of short (2-6 bp) tandemly-repeated nucleotide arrays surrounded by unique flanking sequences (Weber and May 1989). These loci are distributed throughout the genome in high abundance; it is estimated that the mammalian genome may contain in excess of 100,000 to 300,000 such loci, or one locus every 10-30 kilobase pairs (Li 1997). Allelic diversities and heterozygosities are typically extremely high; the presence of 10 or more alleles, and heterozygosities in excess of 0.85, are not uncommon. Microsatellite markers in lentil (about 80) have been developed by ICARDA recently and some of them (30) have already been assigned to linkage groups (Hamwieh et al. 2004, Eujayl et al. 1998).
Microsatellite-DNA markers will be used to obtain baseline data on allelic diversity of a composite germplasm set of lentil. These data will then be used to determine allelic frequency distributions for each locus within the collection as a whole and within source regions, as well as the geographical population genetic structure displayed by these loci among source regions. The analysis of genetic diversity will help elucidate population structures that influence the analysis of the associations between markers and phenotypes for important traits. Phenotypic data will be collected for the population.
5. Objectives: The proposed study rests upon the ability to rapidly, cost-effectively, and unambiguously characterize the genetic make-up of a composite collection of lentil. The requested funds will be used to address three specific objectives:
In addition, the above information can be used to develop future collection and conservation schemes for the genus Lens.
6. Activities and methods
Plant material and DNA extraction:1000 accessions of cultivated lentil and wild Lens will be selected for the study utilizing existing morphological and agronomic data as well as agro-climatological information available in the GRU/ICARDA database (example: Upadhyaya et al 2001). This selection will be representative of the morphological and agronomic diversity of the entire collection, as well as the geographical distribution of the genus and its ecological range. Seed material of the selected accessions will be provided by ICARDA gene bank and will be grown in the plastic house to obtain plant material for DNA extraction. Total genomic DNA will be isolated from young seedlings according to Edwards et al. (1991).
Microsatellite Analysis:Genotyping for 30 SSR loci will be carried out for all 1000 accessions. PCR primer pairs to be utilized for amplification of genomic microsatellite DNA sequences are given in Table 1. Each of these primer pairs have been previously utilized to amplify specific microsatellite loci in Lens, and have been characterized in terms of product size range, number of alleles and heterozygosity for those populations examined (Hamwieh et al., in revision). Primer pairs are selected for study of within locus diversity of populations according to two criteria. First, selected primer pairs yield polymorphic loci. Second, the loci are representative of the entire genome (Hamwieh et al., in revision).
ICARDA: Multifluorophore fragment analysis can be carried out on an ABI prism TM 377 DNA Sequencer and analyzed with GeneScanTM analysis software version 2.0.2 and Genotyper TM analysis software version 2.0 (PE Applied Biosystems) and ABI3100 capillary sequencer with GenMapper software (partially bought with financial support of the Challenge Program).
Kiel: The University of Kiel is having Megabase and Licor sequencers. However, during 2005 they will also acquire ABI sequencers. This should make a data exchange fully compatible.
Data Analysis:Data will be analyzed statistically using Arlequin 2.0 (Schneider et al. 2000). Genotype data from individual lentil accessions will be used to characterize the level of variability at each microsatellite locus. The multilocus genotype data generated for individual accessions will be used to develop estimates of genetic variability for the lentil collection. For each locus, genotype data from the 1000 accessions will be used to characterize the level of variability at each microsatellite locus contributed from the various sources. Genetic variability will be partitioned into within- and among-source region components through hierarchical F-statistics (Nei 1977) as implemented in Arlequin. The degree of population structure among source populations will be estimated through analysis of molecular variance (AMOVA; Excoffier et al. 1992) using Wright’s Fst (Weir and Cockerham 1984). Data will also be analyzed to visualize patterns of population and species relatedness utilizing a three-way analysis.
8. In-kind contributions: The in-kind contribution from ICARDA and U. of Kiel will be in terms of salaries of the scientists and technicians, equivalent to budget for salary/benefits available from CP.
9. Literature cited:
Arumuganathan, K. and E.D. Earle. 1991. Nuclear DNA content of some important plant species. Plant Mol Boil 9: 208-218
Edwards K., Johnstone, C., and C. Thompson. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res 19:1349
Erskine, W. 1996. Lessons for breeder from land races of lentil. Euphytica 93: 107-112
Eujayl, I., M. Baum, W. Powell, W. Erskine and E. Pehu (1998). A genetic linkage map of lentil (Lens sp.) based on RAPD and AFLP markers using recombinant inbred lines. Theor. Appl. Genet. 97: 83-89
Excoffier, L., P. Smouse, and J. Quattro. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131: 479-491.
Furguson, M. and W. Erskine. 2001. Lentils (Lens L.). In Maxted, N. and S.J. Bennett, eds. Plant Genetic Resources of Legumes in the Mediterranean. Kluwer Academic Publishers, Netherlands.
Hamwieh, A., Udupa, S.M., Choumane, W., Sarker, A., Dreyer, F., Jung, C., and M. Baum. A genetic linkage map of Lens sp. Based on microsatellite and AFLP markers and localization of fusarium vascular wilt resistance. TAG, in revision.
Li, W-H. 1997. Molecular evolution. Sinauer Associates, Sunderland, MA.
Morgante,M., and A. M. Olivieri. 1993. PCR-amplified microsatellites as markers in plant genetics. The Plant Journal. 3: 175-182.
Murray, M.G. and W.F. Thompson. 1980. Rapid isolation
of high molecular weight plant DNA. Nucleic Acids Res. 8(19):
4321-4325. Nei, M. 1977. F-statistics and analysis of gene diversity in subdivided populations. Ann. Hum. Genet. 41:225-233.
Schneider, S., D. Roessli, and L. Excoffier. 2000. ARLEQUIN, version 2.000. University of Geneva, Geneva, Switzerland.
Sharma, S.K., Dawson, I.K., and R. Waugh. 1995. Relationships among cultivated and wild lentils revealed by RAPD analysis. Theor. Appl. Genet. 91:647-654.
Upadhyaya, H.D., Bramel, P.J., and S. Singh. 2001. Development of a chickpea core subset using geographic distribution and quantitative traits. Crop Sci. 41: 206-210.
Vendramin, G.G., M. Anzidei, C. Sperisen, M. Morgante, and B. Ziegenhagen. 1998. Chloroplast microsatellites reveal high levels of genetic diversity in conifers: a new tool for biodiversity analysis in forest ecosystems. Acta Hortica, 45: 395-401.
Weber, J.L. and P.E. May. 1989. Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Genet. 44: 388-396.
Weir, B.S. and C.C. Cockerham 1984. Estimating F-statistics for the analysis of population structure. Evolution 38: 1358-1370.
10. Budget: Total budget 30K US $Budget by Activity
Table 1: Lentil microsatellite loci to be used in study, expected PCR product size (bp), annealing temperature used for PCR amplification, and observed size of amplified PCR product (bp).
1(TC)9TATCGATCATCTG(AT)5C(AT)3(GT)14A(TG)7 2(TG)4CTTAAGCCTAGGTAGGAGGCTTATCTCTCAAGTAAAACACCCATAACCTAACAAT(AC)7 3Ungrouped marker AAllele size of ILL 5588 BAllele size of L 692-16-1(s)
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|